pAav-MCS-PQS1-3xFLAG
(Plasmid
#84883)
-
PurposerAAV-based template for genome engineering of protein C-termini containing PQS1 and 3xFLAG tags and a selection cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 84883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufactureragilent
- Backbone size w/o insert (bp) 4650
- Total vector size (bp) 4863
-
Vector typeAAV
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMulticloning sites and selection cassette
-
Alt nameMCS-LOX-PGK-NEO-LOX-MCS
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1962
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site PmlI (destroyed during cloning)
- 5′ sequencing primer CCTCTGACTTGAGCGTCGAT
- 3′ sequencing primer TACTATGGTTGCTTTGACGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
Sequencing over ITR sequences may be difficult. We used additional internal sequencing primers
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAav-MCS-PQS1-3xFLAG was a gift from Sven Eyckerman (Addgene plasmid # 84883 ; http://n2t.net/addgene:84883 ; RRID:Addgene_84883) -
For your References section:
An extra dimension in protein tagging by quantifying universal proteotypic peptides using targeted proteomics. Vandemoortele G, Staes A, Gonnelli G, Samyn N, De Sutter D, Vandermarliere E, Timmerman E, Gevaert K, Martens L, Eyckerman S. Sci Rep. 2016 Jun 6;6:27220. doi: 10.1038/srep27220. 10.1038/srep27220 PubMed 27264994