Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
(Plasmid #85041)


Item Catalog # Description Quantity Price (USD)
Plasmid 85041 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid #42230)
  • Backbone size w/o insert (bp) 7968
  • Total vector size (bp) 10782
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    P1 phage, SV40
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SnaBI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer caagtacgccccctattgacgtcaatgacggtaaat
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova) was a gift from Takuji Iwasato (Addgene plasmid # 85041 ; ; RRID:Addgene_85041)
  • For your References section:

    Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Luo W, Mizuno H, Iwata R, Nakazawa S, Yasuda K, Itohara S, Iwasato T. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. 10.1038/srep35747 PubMed 27775045