This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p-mCherry-N1-slowChloC
(Plasmid #85462)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85462 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 5660
  • Modifications to backbone
    EGFP has been replaced by inserting the complete fusion construct (ChR2-mCherry) using XbaI and BamHI cloning sites
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    slowChloC
  • Alt name
    Channelrhodopsin-2
  • Alt name
    ChR2
  • Species
    Synthetic; Chlamydomonas reinhardtii
  • Insert Size (bp)
    927
  • Mutation
    E90R, T159C, D156N
  • GenBank ID
    EU714030.1
  • Promoter CMV (+enhancer)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer EGFP-N1-F: GAGGTCTATATAAGCAGAGC or CMV-F: GCAAATGGGCGGTAGGCGT
  • 3′ sequencing primer EGFP-C1-R: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-mCherry-N1-slowChloC was a gift from Peter Hegemann (Addgene plasmid # 85462)
  • For your References section:

    Conversion of Channelrhodopsin into a Light-Gated Chloride Channel. Wietek J, Wiegert JS, Adeishvili N, Schneider F, Watanabe H, Tsunoda SP, Vogt A, Elstner M, Oertner TG, Hegemann P. Science. 2014 Mar 27. 10.1126/science.1249375 PubMed 24674867