Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85462)


Item Catalog # Description Quantity Price (USD)
Plasmid 85462 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 5660
  • Modifications to backbone
    EGFP has been replaced by inserting the complete fusion construct (ChR2-mCherry) using XbaI and BamHI cloning sites
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    Synthetic; Chlamydomonas reinhardtii
  • Insert Size (bp)
  • Mutation
    E90R, T159C, D156N
  • GenBank ID
  • Promoter CMV (+enhancer)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 3′ sequencing primer EGFP-C1-R: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-mCherry-N1-slowChloC was a gift from Peter Hegemann (Addgene plasmid # 85462 ; ; RRID:Addgene_85462)
  • For your References section:

    Conversion of Channelrhodopsin into a Light-Gated Chloride Channel. Wietek J, Wiegert JS, Adeishvili N, Schneider F, Watanabe H, Tsunoda SP, Vogt A, Elstner M, Oertner TG, Hegemann P. Science. 2014 Mar 27. 10.1126/science.1249375 PubMed 24674867