1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 8699: HS-H4-GFP
  • H4

  • 320

  • D. melanogaster (fly)

  • His4:CG31611 (Dmel_CG31611, CG31611, Dmel\CG31611)

  • GFP

  • C terminal on backbone

  • na
    (Search Vector Database)

  • Insect Expression

  • 10200

  • XbaI

  • No

  • EagI

  • No

  • na List of Sequencing Primers

  • CCATCTAATTCAACAAGAATTGGG ACAAC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • Kami Ahmad

  • MTA

Comments: 

Heat shock promoter. Ahmad lab #k163.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The histone variant H3.3 marks active chromatin by replication-independent nucleosome assembly. Ahmad et al (Mol Cell 2002 Jun;9(6):1191-200. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 8699" in your Materials and Methods section.