Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Ai14-luc
(Plasmid #87118)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87118 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
  • gRNA/shRNA sequence
    GAGGAACTTCTTAGGGCCCG
  • Species
    Synthetic

Cloning Information

Resource Information

Depositor Comments

There is 11bp deletion in left ITR, which is from original backbone plasmid (i.e. PX551). We don't believe it interfered with packaging.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ai14-luc was a gift from Juan Belmonte (Addgene plasmid # 87118 ; http://n2t.net/addgene:87118 ; RRID:Addgene_87118)
  • For your References section:

    In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Suzuki K, Tsunekawa Y, Hernandez-Benitez R, Wu J, Zhu J, Kim EJ, Hatanaka F, Yamamoto M, Araoka T, Li Z, Kurita M, Hishida T, Li M, Aizawa E, Guo S, Chen S, Goebl A, Soligalla RD, Qu J, Jiang T, Fu X, Jafari M, Esteban CR, Berggren WT, Lajara J, Nunez-Delicado E, Guillen P, Campistol JM, Matsuzaki F, Liu GH, Magistretti P, Zhang K, Callaway EM, Zhang K, Belmonte JC. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. 10.1038/nature20565 PubMed 27851729