pAAV-Ai14-luc
(Plasmid
#87118)
-
PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITI
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 87118 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePX551
-
Backbone manufacturerAddgene 60957
-
Vector typeAAV, CRISPR, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
-
gRNA/shRNA sequenceGAGGAACTTCTTAGGGCCCG
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
There is 11bp deletion in left ITR, which is from original backbone plasmid (i.e. PX551). We don't believe it interfered with packaging.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ai14-luc was a gift from Juan Belmonte (Addgene plasmid # 87118 ; http://n2t.net/addgene:87118 ; RRID:Addgene_87118) -
For your References section:
In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Suzuki K, Tsunekawa Y, Hernandez-Benitez R, Wu J, Zhu J, Kim EJ, Hatanaka F, Yamamoto M, Araoka T, Li Z, Kurita M, Hishida T, Li M, Aizawa E, Guo S, Chen S, Goebl A, Soligalla RD, Qu J, Jiang T, Fu X, Jafari M, Esteban CR, Berggren WT, Lajara J, Nunez-Delicado E, Guillen P, Campistol JM, Matsuzaki F, Liu GH, Magistretti P, Zhang K, Callaway EM, Zhang K, Belmonte JC. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. 10.1038/nature20565 PubMed 27851729