D5 gene in PETCON vector
(Plasmid
#87626)
-
Purposeexpresses D5 allosteric Zn2+ and fluorescein binding antibody for yeast display
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePCTCON2
-
Backbone manufacturerWittrup lab
- Backbone size w/o insert (bp) 6201
- Total vector size (bp) 6975
-
Modifications to backbonenone
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDesigned allosteric Zn2+ and fluorescein binding antibody scFv D5
-
SpeciesSynthetic
-
Insert Size (bp)774
-
Tags
/ Fusion Proteins
- cMyc tag on backbone (C terminal on backbone)
- 3x(G4S) Linker (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer UPGS_fo : GGACAATAGCTCGACGATTGAAGGTAGATACCCATA
- 3′ sequencing primer PCTCON_rev_2: CAGTGTAGATGTAACAAAATCGA (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
D5 gene in PETCON vector was a gift from Sarel Fleishman (Addgene plasmid # 87626 ; http://n2t.net/addgene:87626 ; RRID:Addgene_87626) -
For your References section:
Incorporating an allosteric regulatory site in an antibody through backbone design. Khersonsky O, Fleishman SJ. Protein Sci. 2017 Apr;26(4):807-813. doi: 10.1002/pro.3126. Epub 2017 Mar 6. 10.1002/pro.3126 PubMed 28142198