-
PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 87916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX552
-
Backbone manufacturerFeng Zhang lab
- Total vector size (bp) 5291
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
gRNA/shRNA sequenceSapI cloning site
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BspEI (not destroyed)
- 5′ sequencing primer ctgcgtatgagtgcaagtgggtt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypAAV-minCMV-mCherry (Addgene#27970)
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-U6-sgRNA-hSyn-mCherry was a gift from Alex Hewitt (Addgene plasmid # 87916 ; http://n2t.net/addgene:87916 ; RRID:Addgene_87916) -
For your References section:
AAV-Mediated CRISPR/Cas Gene Editing of Retinal Cells In Vivo. Hung SS, Chrysostomou V, Li F, Lim JK, Wang JH, Powell JE, Tu L, Daniszewski M, Lo C, Wong RC, Crowston JG, Pebay A, King AE, Bui BV, Liu GS, Hewitt AW. Invest Ophthalmol Vis Sci. 2016 Jun 1;57(7):3470-6. doi: 10.1167/iovs.16-19316. 10.1167/iovs.16-19316 PubMed 27367513