Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #87916)


Item Catalog # Description Quantity Price (USD)
Plasmid 87916 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Feng Zhang lab
  • Total vector size (bp) 5291
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • gRNA/shRNA sequence
    SapI cloning site
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BspEI (not destroyed)
  • 5′ sequencing primer ctgcgtatgagtgcaagtgggtt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-U6-sgRNA-hSyn-mCherry was a gift from Alex Hewitt (Addgene plasmid # 87916 ; ; RRID:Addgene_87916)
  • For your References section:

    AAV-Mediated CRISPR/Cas Gene Editing of Retinal Cells In Vivo. Hung SS, Chrysostomou V, Li F, Lim JK, Wang JH, Powell JE, Tu L, Daniszewski M, Lo C, Wong RC, Crowston JG, Pebay A, King AE, Bui BV, Liu GS, Hewitt AW. Invest Ophthalmol Vis Sci. 2016 Jun 1;57(7):3470-6. doi: 10.1167/iovs.16-19316. 10.1167/iovs.16-19316 PubMed 27367513