Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFlpStop-HDR-UAS-2.1-tdTom
(Plasmid #89148)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89148 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC57-mini
  • Backbone manufacturer
    GenScript
  • Backbone size (bp) 7986
  • Vector type
    Insect Expression, CRISPR
  • Promoter 5XUAS, 3XP3-dsRed

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAAGGGAATAAGGGCGACACGGA
  • 3′ sequencing primer ACCGAACTGAGATACCTACAGCGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    the 3XP3 promoter, DsRed coding sequence and the SV40 3’ terminator flanked by loxP sites, phiC31 attP sites, and homology arm multiple cloning sites are identical to those in pHD-DsRed-attP from Gratz et al., 2014
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFlpStop-HDR-UAS-2.1-tdTom was a gift from Tom Clandinin (Addgene plasmid # 89148 ; http://n2t.net/addgene:89148 ; RRID:Addgene_89148)
  • For your References section:

    FlpStop, a tool for conditional gene control in Drosophila. Fisher YE, Yang HH, Isaacman-Beck J, Xie M, Gohl DM, Clandinin TR. Elife. 2017 Feb 17;6. pii: e22279. doi: 10.7554/eLife.22279. 10.7554/eLife.22279 PubMed 28211790