-
Purpose(Empty Backbone) FlpStop plasmid for CRISPR/HDR. Has MCS for homology arms
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC57-mini
-
Backbone manufacturerGenScript
- Backbone size (bp) 7986
-
Vector typeInsect Expression, CRISPR
- Promoter 5XUAS, 3XP3-dsRed
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAAGGGAATAAGGGCGACACGGA
- 3′ sequencing primer ACCGAACTGAGATACCTACAGCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bythe 3XP3 promoter, DsRed coding sequence and the SV40 3’ terminator flanked by loxP sites, phiC31 attP sites, and homology arm multiple cloning sites are identical to those in pHD-DsRed-attP from Gratz et al., 2014
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFlpStop-HDR-UAS-2.1-tdTom was a gift from Tom Clandinin (Addgene plasmid # 89148 ; http://n2t.net/addgene:89148 ; RRID:Addgene_89148) -
For your References section:
FlpStop, a tool for conditional gene control in Drosophila. Fisher YE, Yang HH, Isaacman-Beck J, Xie M, Gohl DM, Clandinin TR. Elife. 2017 Feb 17;6. pii: e22279. doi: 10.7554/eLife.22279. 10.7554/eLife.22279 PubMed 28211790