AAV-syn-ChR2-EYFP-Kv
(Plasmid
#89256)
-
PurposeChannelrhodopsin localized to neuronal soma via a Kv2.1 targeting motif
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 89256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4574
- Total vector size (bp) 6434
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameChannelrhodopsin
-
Alt nameChR2
-
Insert Size (bp)1860
-
MutationH134R
- Promoter synapsin
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccacgcgaggcgcgagatag
- 3′ sequencing primer ttatcgataagcttgatatcgaatt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-syn-ChR2-EYFP-Kv was a gift from McLean Bolton (Addgene plasmid # 89256 ; http://n2t.net/addgene:89256 ; RRID:Addgene_89256)