Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-syn-ChR2-EYFP-Kv
(Plasmid #89256)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89256 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4574
  • Total vector size (bp) 6434
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Channelrhodopsin
  • Alt name
    ChR2
  • Insert Size (bp)
    1860
  • Mutation
    H134R
  • Promoter synapsin
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccacgcgaggcgcgagatag
  • 3′ sequencing primer ttatcgataagcttgatatcgaatt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-syn-ChR2-EYFP-Kv was a gift from McLean Bolton (Addgene plasmid # 89256 ; http://n2t.net/addgene:89256 ; RRID:Addgene_89256)
  • For your References section:

    Cellular resolution circuit mapping with temporal-focused excitation of soma-targeted channelrhodopsin. Baker CA, Elyada YM, Parra A, Bolton MM. Elife. 2016 Aug 15;5. pii: e14193. doi: 10.7554/eLife.14193. 10.7554/eLife.14193 PubMed 27525487