Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #89992)


Item Catalog # Description Quantity Price (USD)
Plasmid 89992 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2647
  • Total vector size (bp) 4897
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4)
  • Promoter none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer M13-fwd tgtaaaacgacggccagt
  • 3′ sequencing primer M13-rv caggaaacagctatgaccatg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    tdTomato sequence was cloned from pCSCMV:tdTomato (a gift from Gerhart Ryffel, Addgene plasmid #30530)
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-OCT4-T2A-NLS-EmGFP-P2A-Puro was a gift from Timo Otonkoski (Addgene plasmid # 89992 ; ; RRID:Addgene_89992)
  • For your References section:

    Generation of an OCT4 reporter human induced pluripotent stem cell line using CRISPR/SpCas9. Balboa D, Weltner J, Novik Y, Eurola S, Wartiovaara K, Otonkoski T. Stem Cell Res. 2017 Aug;23:105-108. doi: 10.1016/j.scr.2017.07.006. Epub 2017 Jul 11. 10.1016/j.scr.2017.07.006 PubMed 28925359