pKL002
(Plasmid #98921)

• Purpose: pET DUET backbone with PROPS voltage indicator and GCaMP6f calcium sensor in the two MCS.
• Depositing Lab: Joel Kralj
• Publication: Bruni et al Proc Natl Acad Sci U S A. 2017 Aug 29;114(35):9445-9450. doi: 10.1073/pnas.1703084114. Epub 2017 Aug 14.

Backbone

• Vector backbone: pETDuet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 7451
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: origin is ColE1 - Incompatibility group A; Depositor recommends BL21 for expression
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PROPS
• Alt name: Proteorhodopsin Optical Proton Sensor
• Alt name: voltage sensor
• Species: Synthetic
• Insert Size (bp): 747
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGCGTCCGGCGTAGA
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Gene/Insert 2

• Gene/Insert name: GCaMP6f
• Species: Synthetic
• Insert Size (bp): 1326
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTGTACACGGCCGCATAATC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pJMK090 - petDUET PROPS+GCaMP6 (Predicted).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry