Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #99249)


Item Catalog # Description Quantity Price (USD)
Plasmid 99249 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Life Technologies
  • Total vector size (bp) 3945
  • Modifications to backbone
    no CMV, added mTyr enh/prom and Cre
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    Cre recombinase
  • Insert Size (bp)
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer GATGTACGGGCCAGATATACGCG
  • 3′ sequencing primer AGTGGGAGTGGCACCTTCCAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mTyr enh/prom
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GATGTACGGGCCAGATATACGCG
  • 3′ sequencing primer AGTGGGAGTGGCACCTTCCAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    For 1 gene in the plasmid (Cre), it originally came from a plasmid originating from Addgene (Connie Cepko)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVAX1/mTyr-Cre was a gift from Christian Blank (Addgene plasmid # 99249 ; ; RRID:Addgene_99249)
  • For your References section:

    Dermal Delivery of Constructs Encoding Cre Recombinase to Induce Skin Tumors in PtenLoxP/LoxP;BrafCA/+ Mice. Deken MA, Song JY, Gadiot J, Bins AD, Kroon P, Verbrugge I, Blank CU. Int J Mol Sci. 2016 Dec 20;17(12). pii: E2149. doi: 10.3390/ijms17122149. 10.3390/ijms17122149 PubMed 27999416