Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #99280)


Item Catalog # Description Quantity Price (USD)
Plasmid 99280 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    AAV pCAG-FLEX-tdTomato-WPRE (Addgene #51503)
  • Backbone manufacturer
    Hongkui Zeng/Allen Institute For Brain Science
  • Backbone size w/o insert (bp) 5719
  • Total vector size (bp) 6440
  • Modifications to backbone
    A fragment containing reverse-complemented mScarlet was swapped into replace tdTomato. Total AAV packaging size (including ITRs and DNA in between) is 3843 bp.
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    monomeric Scarlet
  • Alt name
    mScarlet red fluorescent protein
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer gcaacgtgctggttattgtg
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mScarlet was synthesized de novo based on sequences published by Theodorus W J Gadella Jr's laboratory (Bindels et al, 2017, Nature Methods, PMID:27869816)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV pCAG-FLEX-mScarlet-WPRE was a gift from Rylan Larsen (Addgene plasmid # 99280 ; ; RRID:Addgene_99280)