pAAV-CMV-dSa VP64 Neurog2
(Plasmid
#99695)
-
PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAV
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 99695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV (pUC f1)
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9 and gRNA targeting Neurog2
-
SpeciesSynthetic
-
Mutationdead Cas9
-
Entrez GeneNeurog2 (a.k.a. Atoh4, Math4A, bHLHa8, ngn-2, ngn2)
-
Tag
/ Fusion Protein
- VP64 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
Depositor Comments
gRNA: GGTATATAAGGGGTTTTAAG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-dSa VP64 Neurog2 was a gift from George Church (Addgene plasmid # 99695 ; http://n2t.net/addgene:99695 ; RRID:Addgene_99695)