Showing: 241 - 260 of 18716 results
-
Plasmid#59359PurposeLentiviral expression vector: Neuroligin 3 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterCAG and mouse U6AvailabilityAcademic Institutions and Nonprofits only
-
pLenLox_U6 p53
Plasmid#59360PurposeLentiviral expression vector: p53 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorInsertsUseLentiviralTagsExpressionMammalianMutationPromoterCAG and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
Lenti.pFOXA2.GFP
Plasmid#59404Purposeexpresses eGFP from a 400 bp human FOXA2 promoter to select floor plate and ventral midbrain progenitor cells during developmentDepositorInsert400 bp FOXA2 promoter, eGFP (FOXA2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterpFOXA2AvailabilityAcademic Institutions and Nonprofits only -
Lenti.pFOXA2.5'.GFP
Plasmid#59407Purposeexpresses eGFP from an about 1350 bp human FOXA2 promoter to select floor plate and ventral midbrain progenitor cells during developmentDepositorInsertapprox. 1350 bp FOXA2 promoter, eGFP (FOXA2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterFOXA2AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV-IFP2.0 T2A HO1
Plasmid#59427PurposeExpress infrared fluorescent protein IFP2.0 plus HO1 enzymeDepositorInsertIFP2.0T2AHO1 IRES EGFP
UseLentiviralTagsExpressionMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pUltra-Smurf-luc-RTTA3
Plasmid#59438Purposesilence doxycyclin inducible pUltra-dox (also expresses luciferase)DepositorInsertsluciferase
Reverse TET-Transactivator 3
UseLentiviralTagsExpressionMammalianMutationloxP5171PromoterAvailabilityAcademic Institutions and Nonprofits only -
-
pLV-Enh eGFP Reporter-muHRNR-X50
Plasmid#59451PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of mouse HMR.DepositorInsertHrnr
UseLentiviralTagsExpressionMutationPromoterMu Hsp68 minimal promoterAvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC1-IGR16
Plasmid#59453PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type I cluster.DepositorInsertmK10-IGR5
UseLentiviralTagsExpressionMutationPromoterMu Hsp68 minimal promoterAvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muEDC-IGR17
Plasmid#59454PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the mouse Epidermal Differentiation Complex.DepositorInsertmLor-IGR3
UseLentiviralTagsExpressionMutationPromoterMu Hsp68 minimal promoterAvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC1-IGR20
Plasmid#59455PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the mouse keratin type I cluster.DepositorInsertmKrt14-5IGR
UseLentiviralTagsExpressionMutationPromoterMu Hsp68 minimal promoterAvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-huKC2-IGR21
Plasmid#59456PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the human keratin type II cluster.DepositorInserthuKrt1 3’intergenic region
UseLentiviralTagsExpressionMutationPromoterMu Hsp68 minimal promoterAvailabilityAcademic Institutions and Nonprofits only -
pSicoR-UBE2D3i1
Plasmid#59586PurposeExpression of shRNA against human UBE2D3DepositorInsertUBE2D3
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pJZC35
Plasmid#62325PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralTagsExpressionMammalianMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralTagsExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6AvailabilityAcademic Institutions and Nonprofits only
Showing: 241 - 260 of 18716 results