Showing: 81 - 100 of 250 results
-
Plasmid#165584PurposeNative CcmO fusion with a StrepII tag and PDTDepositorInsertCcmO-PDT
UseTagsProtein degradation tagExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRTagsExpressionMutationS264A, and silent mutation to remove PAM sitePromoterAvailabilityAcademic Institutions and Nonprofits only -
pOPO640
Plasmid#195296PurposepTA106-Myacmini-KanR, donor plasmid with mini-transposon of McCAST (Tn7575).DepositorInsertminiMcCAST (Tn7575) with KanR
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
KaiC CI cat- (E77Q;E78Q)
Plasmid#41886DepositorInsertKaiC CI cat -(E77Q;E78Q)
UseTagsExpressionBacterialMutationchanged glutamic acid 77 and 78 to glutaminePromotert7 promoterAvailabilityAcademic Institutions and Nonprofits only -
KaiC CII cat- (E318Q)
Plasmid#41887DepositorInsertKai C CII cat (E318Q)
UseBl de3 21TagsExpressionBacterialMutationchanged amino acid 318 E to QPromotert7AvailabilityAcademic Institutions and Nonprofits only -
KaiC CI cat-/EE (E77Q; E78Q; S431E; T432E)
Plasmid#41888DepositorInsertKai C CI cat-/EE
UseTagsExpressionBacterialMutationchanged amin acids: 77,78,431 and 432 to glutamatePromotert7AvailabilityAcademic Institutions and Nonprofits only -
KaiC CII cat-/EE (E318Q; S431E; T432E)
Plasmid#42498DepositorInsertKaiC CII cat-/EE (E318Q; S431E; T432E)
UseTagsExpressionBacterialMutationE318Q; S431E; T432EPromotert7AvailabilityAcademic Institutions and Nonprofits only -
pOPO635
Plasmid#195297PurposepACYC-plac-MycaTnsABC, lac promoter expressing transposase genes TnsABC of McCAST (Tn7575).DepositorInsertTnsABC operon of McCAST (Tn7575)
UseTagsExpressionBacterialMutationPromoterIPTG inducible lac promoterAvailabilityAcademic Institutions and Nonprofits only -
pOPO636
Plasmid#195299PurposepACYC-plac-MycaTnsABCQ, lac promoter expressing transposase genes TnsABCQ of McCAST (Tn7575).DepositorInsertTnsABCQ operon of McCAST (Tn7575)
UseTagsExpressionBacterialMutationPromoterIPTG inducible lac promoterAvailabilityAcademic Institutions and Nonprofits only -
pOPO646
Plasmid#195307PurposepBAD322-MycaTnsD, arapBAD promoter expressing cyanobacterial tRNA-Leu gene targeting TnsD protein of McCAST (Tn7575).DepositorInsertTnsD of McCAST
UseTagsExpressionBacterialMutationPromoterArabinose inducible arapBADAvailabilityAcademic Institutions and Nonprofits only -
pJ207 Delta-cpc-KanR
Plasmid#51468PurposeDeletes the cpc operon in Synechocystis and confers kanamycin resistanceDepositorInsertReplacing the cpc operon with kanamycin resistance
UseSynthetic BiologyTagsExpressionMutationPromoterSynechocystis endogenous cpc-operon promoterAvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-Ppsba2-dCas9-SpR
Plasmid#73220PurposeContains dCas9 from S. pyogenes under constitutive promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
UseTagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPpsbA2AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-TetR-PL22-dCas9-SpR
Plasmid#73223PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
UseTagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPL22AvailabilityAcademic Institutions and Nonprofits only -
RNA polymerase beta prime subunit FLAG
Plasmid#102337PurposeTargeting plasmids for replacing the S. elongatus PCC 7942 genomic copy of Synpcc7942_1524 (Beta prime subunit of RNA polymerase) with a C-terminal FLAG tagged variant.DepositorInsertRNAP Beta Prime Subunit with C-terminal FLAG TAG
UseTags3x FLAG with 3X GSGS linkerExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pC0.170
Plasmid#119638PurposeLevel 0 Part. Insertion siteDepositorInsert6803 NS3 Down Flank
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pC0.172
Plasmid#119640PurposeLevel 0 Part. Insertion siteDepositorInsert6803 NS4 Down Flank
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pC0.173
Plasmid#119642PurposeLevel 0 Part. Insertion siteDepositorInsert7942 NS1 Up Flank
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pC0.177
Plasmid#119646PurposeLevel 0 Part. Insertion siteDepositorInsert7942 NS3 Up Flank
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pC0.281
Plasmid#119647PurposeLevel 0 Part. Insertion siteDepositorInsert7002 NS2 UP Flank
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pC0.282
Plasmid#119648PurposeLevel 0 Part. Insertion siteDepositorInsert7002 NS2 DOWN Flank
UseSynthetic BiologyTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 81 - 100 of 250 results