Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 34 of 34 results

  3. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...Flp recombinases to remove genes flanked by either loxP or frt sites respectively, and empty vectors to ...

  4. Zhang Lab CRISPR Page

    Type
    Collection
    ...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP recombination and fluorescence assisted sorting ...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid facilitates Cre/loxP recombination and fluorescence assisted sorting ...

  6. Zebrafish Plasmid Collection

    Type
    Collection
    ...Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that enables precise temporal and spatial...

  7. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...recombination events at the genetic level. Upon Cre/loxP recombination, each transgene expresses one of three...recombinase/FRT system in place of Brainbow’s Cre/loxP, allowing for simultaneous use of the two systems...

  10. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...Lab used this backbone to target a CAG-driven loxP-stop-loxP cassette into the Rosa26 locus, allowing for...

  12. Validated gRNA Sequences

    Type
    Collection
    ...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S...
Showing: 21 - 34 of 34 results