pCAGGS-PHFF
(Plasmid #100280)

• Purpose: Expression vector for phycocyanobilin (PCB) synthesis in mammalian cells.
• Depositing Lab: Kazuhiro Aoki
• Publication: Uda et al Proc Natl Acad Sci U S A. 2017 Oct 24. pii: 201707190. doi: 10.1073/pnas.1707190114.

Backbone

• Vector backbone: pCAGGS
• Backbone manufacturer: Junichi Miyazaki (Osaka University, Japan)
• Backbone size w/o insert (bp): 4870
• Total vector size (bp): 8551
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
• Alt name: PHFF (synthetic genes)
• Alt name: PcyA (Phycocyanobilin:ferredoxin oxidoreductase), HO1 (Heme Oxigenase 1), Fd (Ferredoxin), Fnr (Ferredoxin-NADP+ reductase)
• Species: Thermosynechococcus elongatus bp-1 for PcyA and HO1, and Synechocystis sp. PCC 6803 for Fd and Fnr.
• Insert Size (bp): 3681
• Mutation: All genes are codon-optimized for expression in human cells.
• Promoter: CAG promoter
• Tags / Fusion Proteins:
  • Mitochondria-targeting sequence (MTS), HA, Myc (N terminal on insert)
  • FLAG, T7 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: catgttcatgccttcttctttttcc
• 3′ sequencing primer: agatgctcaaggggcttcatgatg

Resource Information

• Supplemental Documents:
  • pCAGGS-PHFF.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expression vector for Phycocyanobilin (PCB) synthesis in mammalian cells.