Skip to main content

B52 + PIK3R1 sgSTOP
(Plasmid #100714)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100714 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    B52 plasmid expressing PIK3R1 sgSTOP and containing an empty sgRNA-expression cassette
  • Total vector size (bp) 2636
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgSTOP targeting PIK3R1 (cloned using BbsI)
  • gRNA/shRNA sequence
    sgSTOP PIK3R1: AACTTCGAGATACAGCAGAC
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGTACCTCGAGGAATTCTCTAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    B52 + PIK3R1 sgSTOP was a gift from Alberto Ciccia (Addgene plasmid # 100714 ; http://n2t.net/addgene:100714 ; RRID:Addgene_100714)
  • For your References section:

    CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Billon P, Bryant EE, Joseph SA, Nambiar TS, Hayward SB, Rothstein R, Ciccia A. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008. 10.1016/j.molcel.2017.08.008 PubMed 28890334