pProEx-Htb-NAvi-His-LOV2 C450A
(Plasmid #101146)

• Purpose: The dark state (C450A) mutant of the LOV2 domain of Avena sativa (oat) phototropin1 (404–546) in bacterial expression vector pProEx–HTb. Contains N-terminal His6 tag followed by an Avi tag
• Depositing Lab: Klaus Hahn
• Depositing Organization: University of North Carolina at Chapel Hill
  Located in United States of America
• Publication: Wang et al Curr Protoc Cell Biol. 2016 Dec 1;73:21.10.1-21.10.14. doi: 10.1002/cpcb.12.

Backbone

• Vector backbone: pProEx-Htb
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4779
• Total vector size (bp): 5346
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LOV2(C450A)
• Species: Avena sativa
• Insert Size (bp): 432
• Mutation: C450A
• Promoter: Lac
• Tags / Fusion Proteins:
  • His6
  • Avi

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: GGAATTGTGAGCGGATAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry