pCZGY3163
(Plasmid #101248)

• Purpose: GFP11::rps-18, ribosomal protein subunit, bound to C-terminal part of GFP. Shows GFP localized to ribosomes when combined with GFP 1-10.
• Depositing Lab: Yishi Jin
• Depositing Organization: University of California, San Diego (UCSD)
  Located in United States of America
• Publication: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

Backbone

• Vector backbone: pCR8 Gateway Entry Vector
• Backbone size w/o insert (bp): 3545
• Total vector size (bp): 4320
• Vector type: Gateway Cloning

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gfp11::rps-18
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 775
• Entrez Gene: rps-18 (a.k.a. CELE_Y57G11C.16)
• Tag / Fusion Protein:
  • GFP11

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: ccctctactcaatttcagcaaaaa
• 3′ sequencing primer: tctttaataatgtttgcctcgatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When using this clone for publication, please reference:
Noma K, Goncharov A, Ellisman MH, Jin Y. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

DNA (Catalog # 101248-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 101248-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.