Skip to main content

pCZGY3163
(Plasmid #101248)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101248 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 101248-D50 50 μg of DNA in Tris buffer $495
DNA 101248-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCR8 Gateway Entry Vector
  • Backbone size w/o insert (bp) 3545
  • Total vector size (bp) 4320
  • Vector type
    Gateway Cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gfp11::rps-18
  • Species
    C. elegans (nematode), Synthetic
  • Insert Size (bp)
    775
  • Entrez Gene
    rps-18 (a.k.a. CELE_Y57G11C.16)
  • Tag / Fusion Protein
    • GFP11

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ccctctactcaatttcagcaaaaa
  • 3′ sequencing primer tctttaataatgtttgcctcgatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When using this clone for publication, please reference:
Noma K, Goncharov A, Ellisman MH, Jin Y. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY3163 was a gift from Yishi Jin (Addgene plasmid # 101248 ; http://n2t.net/addgene:101248 ; RRID:Addgene_101248)
  • For your References section:

    Microtubule-dependent ribosome localization in C. elegans neurons. Noma K, Goncharov A, Ellisman MH, Jin Y. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. 10.7554/eLife.26376 PubMed 28767038