Skip to main content

pCRRNA-G20-R20
(Plasmid #101822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101822 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 101822-D50 50 μg of DNA in Tris buffer $495
DNA 101822-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCRRNAcos
  • Backbone size w/o insert (bp) 2870
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    crRNAs targeting GFP and mCherry
  • gRNA/shRNA sequence
    sfGFP crRNA: CCTTCACCTTCACCACGAACAGAGAATTTG; mCherry crRNA: AGTTTGGCGGTCTGGGTGCCTTCATACGGA
  • Species
    Synthetic
  • Promoter Spy 1049

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer TTACTTTGCAGGGCTTCCCAACC
  • 3′ sequencing primer TTTGATGCCTCTAGCACGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRRNA-G20-R20 was a gift from David Bikard & Sven van Teeffelen (Addgene plasmid # 101822 ; http://n2t.net/addgene:101822 ; RRID:Addgene_101822)
  • For your References section:

    Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Vigouroux A, Oldewurtel E, Cui L, Bikard D, van Teeffelen S. Mol Syst Biol. 2018 Mar 8;14(3):e7899. PubMed 29519933