-
Purposeexpress sgRNA, p15A, CRM
-
Depositing Lab
-
Depositing OrganizationInstitut Pasteur
Located in France -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 114006-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 114006-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepsgRNA
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceTGAGACCAGTCTAGGTCTCG
-
SpeciesE. coli
- Promoter BBa_J23119
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GCTAGGAGGTGACTGAAGTAT
- 3′ sequencing primer AGCAGTGTGACCGTGTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 114006-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 114006-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psgRNAc was a gift from David Bikard (Addgene plasmid # 114006 ; http://n2t.net/addgene:114006 ; RRID:Addgene_114006) -
For your References section:
A CRISPRi screen in E. coli reveals sequence-specific toxicity of dCas9. Cui L, Vigouroux A, Rousset F, Varet H, Khanna V, Bikard D. Nat Commun. 2018 May 15;9(1):1912. doi: 10.1038/s41467-018-04209-5. 10.1038/s41467-018-04209-5 [pii] PubMed 29765036