Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pmTurqoise KIF1A shRNA
(Plasmid #102849)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102849 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSuper
  • Backbone manufacturer
    Oligoengine
  • Backbone size w/o insert (bp) 5415
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KIF1A-shRNA
  • Alt name
    ATSV, Kns1
  • gRNA/shRNA sequence
    TACCTATGTGAACGGCAAG
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    KIF1A
  • Promoter H1-RNA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer T7 TAATACGACTCACTATAGGG , M13R CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pmTurquoise KIF1A shRNA vector was constructed by restriction site removal of eGFP from the commercially available pSuper vector (Oligoengine) and insertion of the cDNA coding for pmTurquoise (Addgene plasmid #36202).
The reference for the pSuper Vector (Oligoengine) is T.R. Brummelkamp, R. Bernards, and R Agami, Science 296, 550 (2002).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmTurqoise KIF1A shRNA was a gift from Erik Dent (Addgene plasmid # 102849 ; http://n2t.net/addgene:102849 ; RRID:Addgene_102849)
  • For your References section:

    Transport of a kinesin-cargo pair along microtubules into dendritic spines undergoing synaptic plasticity. McVicker DP, Awe AM, Richters KE, Wilson RL, Cowdrey DA, Hu X, Chapman ER, Dent EW. Nat Commun. 2016 Sep 23;7:12741. doi: 10.1038/ncomms12741. 10.1038/ncomms12741 PubMed 27658622