-
PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editing
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 102851-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 102851-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePX462
- Total vector size (bp) 9200
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1
-
SpeciesH. sapiens (human), Synthetic; S. pyogenes
-
Insert Size (bp)6852
-
Entrez GeneGRIN2B (a.k.a. DEE27, EIEE27, GluN2B, MRD6, NMDAR2B, NR2B, NR3, hNR3)
- Promoter U6 promoter
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- 3X Flag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gagggcctatttcccatgat
- 3′ sequencing primer aattaagcccaccttgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 102851-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 102851-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-hGRIN2B-CAG-ps-SpCas9 was a gift from Michael Lin (Addgene plasmid # 102851 ; http://n2t.net/addgene:102851 ; RRID:Addgene_102851) -
For your References section:
A Single-Chain Photoswitchable CRISPR-Cas9 Architecture for Light-Inducible Gene Editing and Transcription. Zhou XX, Zou X, Chung HK, Gao Y, Liu Y, Qi LS, Lin MZ. ACS Chem Biol. 2017 Sep 29. doi: 10.1021/acschembio.7b00603. 10.1021/acschembio.7b00603 PubMed 28938067