Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

VPR-ps-dSpCas9
(Plasmid #102855)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102855 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPB
  • Backbone manufacturer
    System Biosciences
  • Total vector size (bp) 15460
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dSpCas9, pdDronpa1.2
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    7639
  • Promoter PGK
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • VP64-p64-Rta transcription activator (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGAGGCCCGGCATTCTG
  • 3′ sequencing primer CGCGTATACTAGATTAACCCTAGAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VPR-ps-dSpCas9 was a gift from Michael Lin (Addgene plasmid # 102855 ; http://n2t.net/addgene:102855 ; RRID:Addgene_102855)
  • For your References section:

    A Single-Chain Photoswitchable CRISPR-Cas9 Architecture for Light-Inducible Gene Editing and Transcription. Zhou XX, Zou X, Chung HK, Gao Y, Liu Y, Qi LS, Lin MZ. ACS Chem Biol. 2017 Sep 29. doi: 10.1021/acschembio.7b00603. 10.1021/acschembio.7b00603 PubMed 28938067