Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

U6-hGRIN2B-CAG-ps-SaCas9
(Plasmid #102853)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102853 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX462
  • Total vector size (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1
  • Species
    H. sapiens (human), Synthetic; S. aureus
  • Insert Size (bp)
    5872
  • Entrez Gene
    GRIN2B (a.k.a. EIEE27, GluN2B, MRD6, NMDAR2B, NR2B, NR3, hNR3)
  • Promoter U6 promoter;
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3X Flag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagggcctatttcccatgat
  • 3′ sequencing primer aattaagcccaccttgc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6-hGRIN2B-CAG-ps-SaCas9 was a gift from Michael Lin (Addgene plasmid # 102853 ; http://n2t.net/addgene:102853 ; RRID:Addgene_102853)
  • For your References section:

    A Single-Chain Photoswitchable CRISPR-Cas9 Architecture for Light-Inducible Gene Editing and Transcription. Zhou XX, Zou X, Chung HK, Gao Y, Liu Y, Qi LS, Lin MZ. ACS Chem Biol. 2017 Sep 29. doi: 10.1021/acschembio.7b00603. 10.1021/acschembio.7b00603 PubMed 28938067