Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUDE731
(Plasmid #103008)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 103008 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMEL10
  • Backbone manufacturer
    Mans, R. et al (2015) CRISPR/Cas9: a molecular Swiss army knife FEMS Yeast Res 15
  • Backbone size w/o insert (bp) 5658
  • Total vector size (bp) 9695
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fncpf1
  • Species
    Francisella tularensis subsp. novicida U112
  • Insert Size (bp)
    4038
  • Mutation
    human codon optimized
  • GenBank ID
    CP000439.1 CP000439.1
  • Promoter TEF1
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3HA (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCTACGGTTCCCGAAGTATGCTGCTGATGTCTGGCTATACCTATCCGTCTACGTGAATACCCTCACTAAAGGGAACAAAAG
  • 3′ sequencing primer GTTGAACATTCTTAGGCTGGTCGAATCATTTAGACACGGGCATCGTCCTCTCGAAAGGTGGGCCGCAAATTAAAGCCTTCGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid # 69976--Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. 10.1016/j.cell.2015.09.038 PubMed 26422227
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDE731 was a gift from Jean-Marc Daran (Addgene plasmid # 103008 ; http://n2t.net/addgene:103008 ; RRID:Addgene_103008)
  • For your References section:

    FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. Świat MA, Dashko S, den Ridder M, Wijsman M, van der Oost J, Daran JM Daran-Lapujade P.. Nucleic Acids Research (2017), gkx1007 10.1093/nar/gkx1007