Skip to main content
Addgene
Open Menu

pCAGGS_HA-VP35_EBOV
(Plasmid #103053)

Print

Ordering

Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 103053 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 103053-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 103053-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCAGGs
  • Total vector size (bp) 5831
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VP35
  • Alt name
    VP35 gene of Ebola virus
  • Species
    Zaire ebolavirus, Mayinga
  • Entrez Gene
    VP35 (a.k.a. ZEBOVgp2)
  • Promoter CAG
  • Tag / Fusion Protein
    • HA-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn 1 (unknown if destroyed)
  • 3′ cloning site Not 1 (unknown if destroyed)
  • 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS_HA-VP35_EBOV was a gift from Elke Mühlberger (Addgene plasmid # 103053 ; http://n2t.net/addgene:103053 ; RRID:Addgene_103053)

  • For your References section:

    Ebola Virus Does Not Induce Stress Granule Formation during Infection and Sequesters Stress Granule Proteins within Viral Inclusions. Nelson EV, Schmidt KM, Deflube LR, Doganay S, Banadyga L, Olejnik J, Hume AJ, Ryabchikova E, Ebihara H, Kedersha N, Ha T, Muhlberger E. J Virol. 2016 Jul 27;90(16):7268-84. doi: 10.1128/JVI.00459-16. Print 2016 Aug 15. 10.1128/JVI.00459-16 PubMed 27252530
Related items:
Commonly requested with: