pUC19-E3CY56
(Plasmid
#103075)
-
PurposeCas9 coding gene template with optimized sequence for human codon usage
-
Depositing Lab
-
Depositing OrganizationYonsei University
Located in Republic of Korea -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 103075-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 103075-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNEB(New England Biolabs)
-
Vector typeCRISPR ; Cloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE3CY56(Cas9 coding gene from Aminomonas paucivorans DSM 12260)
-
Insert Size (bp)3157
-
Mutationhuman codon-optimized
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctgcaaggcgattaagttg
- 3′ sequencing primer cggctcgtatgttgtgtgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 103075-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 103075-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-E3CY56 was a gift from Duhee Bang (Addgene plasmid # 103075 ; http://n2t.net/addgene:103075 ; RRID:Addgene_103075) -
For your References section:
High-throughput construction of multiple cas9 gene variants via assembly of high-depth tiled and sequence-verified oligonucleotides. Cho N, Seo HN, Ryu T, Kwon E, Huh S, Noh J, Yeom H, Hwang B, Ha H, Lee JH, Kwon S, Bang D. Nucleic Acids Res. 2018 May 18;46(9):e55. doi: 10.1093/nar/gky112. 10.1093/nar/gky112 PubMed 29529247