pAF257
(Plasmid
#105497)
-
PurposepRPF185 derived plasmid encoding an anhydrotetracyclin inducible SmBiT and HupA-LgBiT
-
Depositing Lab
-
Depositing OrganizationLeiden University Medical Center
Located in Netherlands -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105497 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105497-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105497-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepRPF185
-
Backbone manufacturerR.P. Fagan, University of Sheffield
- Total vector size (bp) 8073
-
Vector typeATc-dependent expression in C. difficile
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSmBiT/HupA-LgBiT
-
SpeciesC. difficile / synthetic
-
Insert Size (bp)897
- Promoter Ptet
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTGGACTTCATGAAAAACTAAAAAAAATATTG
- 3′ sequencing primer CACCGACGAGCAAGGCAAGACCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/09/27/426809 for bioRxiv preprint.
DNA (Catalog # 105497-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105497-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAF257 was a gift from Wiep Klaas Smits (Addgene plasmid # 105497 ; http://n2t.net/addgene:105497 ; RRID:Addgene_105497) -
For your References section:
The Bacterial Chromatin Protein HupA Can Remodel DNA and Associates with the Nucleoid in Clostridium difficile. Oliveira Paiva AM, Friggen AH, Qin L, Douwes R, Dame RT, Smits WK. J Mol Biol. 2019 Jan 8. pii: S0022-2836(18)31160-4. doi: 10.1016/j.jmb.2019.01.001. 10.1016/j.jmb.2019.01.001 PubMed 30633871