Skip to main content

CLYBL-(Ef1a-SBP-LNGFR-T2A-mApple)-(CAG-rtTA)-(TRE-hNIL))
(Plasmid #105842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105842 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 105842-D50 50 μg of DNA in Tris buffer $495
DNA 105842-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUCM
  • Backbone manufacturer
    custom
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 14168
  • Modifications to backbone
    CLYBL homology arms
  • Vector type
    CRISPR, TALEN
  • Selectable markers
    Puromycin ; SBP-LNGFR for bead selection

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Neurogenin 2
  • Alt name
    NGN2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    819
  • GenBank ID
    NM_024019
  • Entrez Gene
    NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
  • Promoter TRE3G

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    ISL LIM Homeobox 1
  • Alt name
    ISL1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1050
  • GenBank ID
    NM_002202
  • Entrez Gene
    ISL1 (a.k.a. ISLET1, Isl-1)
  • Promoter TRE3G

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    LIM Homeobox 3
  • Alt name
    LHX3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1209
  • Entrez Gene
    LHX3 (a.k.a. CPHD3, LIM3, M2-LHX3)
  • Promoter TRE3G

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGCATGGTAGCCAGTCCTATTG
  • 3′ sequencing primer TGTGGAATTGTGAGCGGATA
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Optimized mApple
  • Alt name
    Optimized mApple
  • Species
    Synthetic
  • Insert Size (bp)
    708
  • Promoter EF-1alpha

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
    rtTA3G
  • Alt name
    rtTA3G
  • Insert Size (bp)
    747
  • Promoter CAG

Cloning Information for Gene/Insert 5

Gene/Insert 6

  • Gene/Insert name
    SBP Delta-LNGFR
  • Alt name
    SBP Delta-LNGFR
  • Insert Size (bp)
    738
  • Promoter EF-1alpha

Cloning Information for Gene/Insert 6

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Tre3G and rTTA are from Clontech Plasmid (TetOne Lenti Vector)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CLYBL-(Ef1a-SBP-LNGFR-T2A-mApple)-(CAG-rtTA)-(TRE-hNIL)) was a gift from Michael Ward (Addgene plasmid # 105842 ; http://n2t.net/addgene:105842 ; RRID:Addgene_105842)
  • For your References section:

    Transcription Factor-Mediated Differentiation of Human iPSCs into Neurons. Fernandopulle MS, Prestil R, Grunseich C, Wang C, Gan L, Ward ME. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. doi: 10.1002/cpcb.51. Epub 2018 May 18. 10.1002/cpcb.51 PubMed 29924488