Phi3-GCaMP6f
(Plasmid #106298)

• Purpose: CMV driven GFP based calcium (Ca2+) reporter
• Depositing Lab: Sanford Simon
• Publication: Belote et al J Cell Biol. 2020 Jan 6;219(1). pii: 132739. doi: 10.1083/jcb.201902014.

Backbone

• Vector backbone: PLVX Puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 8151
• Total vector size (bp): 9504
• Modifications to backbone: MCS was modified as described in Takacs, C.N., et al., (2017) Traffic 18, 192-204.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6f
• Alt name: GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
• Alt name: GCaMP3 variant 693
• Species: R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
• Insert Size (bp): 1353
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (GCaMP6f) and BamHI (Phi3) (destroyed during cloning)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GCGCATGCTCCAGACTGCC

Resource Information

• Supplemental Documents:
  • 106298phi3-gcamp6f.gb
• A portion of this plasmid was derived from a plasmid made by: GCaMP6f was from Douglas Kim, Addgene plasmid # 40755

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry