JGE301_pAAV-hSyn-DIO-Flag-hM3Dq-V2(2D)-ABIcs-mCherry
(Plasmid #107246)

• Purpose: hM3DREADD fused to ABIcs for abscisic acid mediated recruitment of PYLcs labelled proteins.
• Depositing Lab: Bryan Roth
• Publication: Roth et al bioRxiv 251769

Backbone

• Vector backbone: AAV2
  (Search Vector Database)
• Backbone size w/o insert (bp): 6597
• Total vector size (bp): 8454
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: hM3DREADD
• Alt name: Gq DREADD
• Species: Synthetic
• Insert Size (bp): 1776
• Mutation: T to D and S to D mutations in V2-tail
• Promoter: hSYN
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • ABIcs (C terminal on insert)
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cgctgcctcagtctgcggtg
• 3′ sequencing primer: ggagaaaatgaaagccatacgggaagcaatag

Resource Information

• Supplemental Documents:
  • jge301_paav-hsyn-dio-flag-hm3dq-v22d-abics-mcherry.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/01/22/251769 for bioRxiv preprint.