pBV65
(Plasmid #108363)

• Purpose: A nourseothricin resistance marker used to construct gene disruptions in Candida glabrata. The natMX6 marker can be evicted by growth on media lacking methionine and containing estradiol.
• Depositing Lab: Scott Moye-Rowley
• Publication: Vu et al mSphere. 2018 Mar 28;3(2). pii: mSphere00099-18. doi: 10.1128/mSphere.00099-18. eCollection 2018 Mar-Apr.

Backbone

• Vector backbone: pFA6a
• Backbone size w/o insert (bp): 2468
• Total vector size (bp): 8096
• Modifications to backbone: loxP sites flank insert
• Vector type: Gene disruption marker for Candida glabrata
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: loxP-natMX6-CgMET3prom-cre-loxP
• Alt name: Recyclable nat cassette
• Species: Candida glabrata
• Promoter: C. glabrata MET3

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtacgctgcaggtcgacaac
• 3′ sequencing primer: gccactagtggatctgatatcacc

Resource Information

• Supplemental Documents:
  • pBV65 (pUG-loxp-nat-MET3-CREintron-loxp).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry