pGEX6P1‐hsRNASEH2BCA
(Plasmid #108692)

• Purpose: For expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A, allowing affinity purification of the RNase H2 trimeric enzyme
• Depositing Labs: Andrew Jackson, Martin Reijns
• Publication: Reijns et al J Biol Chem. 2011 Mar 25;286(12):10530-9. doi: 10.1074/jbc.M110.177394. Epub 2010 Dec 22.

Backbone

• Vector backbone: pGEX6P1
• Backbone manufacturer: Amersham
• Backbone size w/o insert (bp): 4984
• Total vector size (bp): 7400
• Modifications to backbone: SacI site added between between RNASEH2A stop codon and NotI site
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: RNASEH2B
• Species: H. sapiens (human)
• Insert Size (bp): 938
• Mutation: excluding methionine start
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CGTCGCCGCTCTCCATATG

Gene/Insert 2

• Gene/Insert name: RNASEH2C
• Species: H. sapiens (human)
• Mutation: Shine Dalgarno sequence upstream of start codon
• Entrez Gene: RNASEH2C (a.k.a. AGS3, AYP1)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: AATTGGAAAGGTTTGAAACGAC
• 3′ sequencing primer: CTGTATTGTCTCTCTCCAGC

Gene/Insert 3

• Gene/Insert name: RNASEH2A
• Species: H. sapiens (human)
• Insert Size (bp): 900
• Mutation: Shine Dalgarno sequence upstream of start codon

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SacI/NotI (not destroyed)
• 5′ sequencing primer: ATTCACGCACAGGTGCCCG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Resource Information

• Supplemental Documents:
  • pGEX6P1-hsRNASEH2BCA.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry