Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pEGFP‐RNASEH2C
(Plasmid #108698)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 108698 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-Dest (LMBP 4542)
  • Backbone manufacturer
    LMBP
  • Backbone size w/o insert (bp) 4798
  • Total vector size (bp) 5293
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RNASEH2C
  • Species
    H. sapiens (human)
  • Entrez Gene
    RNASEH2C (a.k.a. AGS3, AYP1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgatcacatggtcctgctg
  • 3′ sequencing primer tctacaaatgtggtatggctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP‐RNASEH2C was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 108698 ; http://n2t.net/addgene:108698 ; RRID:Addgene_108698)
  • For your References section:

    PCNA directs type 2 RNase H activity on DNA replication and repair substrates. Bubeck D, Reijns MA, Graham SC, Astell KR, Jones EY, Jackson AP. Nucleic Acids Res. 2011 May;39(9):3652-66. doi: 10.1093/nar/gkq980. Epub 2011 Jan 17. 10.1093/nar/gkq980 PubMed 21245041