Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pU6-crRNA(TARDBP)
(Plasmid #109323)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 109323 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry-KASH
  • gRNA/shRNA sequence
    ATGGGAGACCCAACACTATTAAA (TARDBP)
  • Species
    H. sapiens (human)
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)
  • Promoter hSyn1

Cloning Information

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-crRNA(TARDBP) was a gift from Feng Zhang (Addgene plasmid # 109323 ; http://n2t.net/addgene:109323 ; RRID:Addgene_109323)
  • For your References section:

    Effects of 3D culturing conditions on the transcriptomic profile of stem-cell-derived neurons. Tekin, Halil, Sean Simmons, Beryl Cummings, Linyi Gao, Xian Adiconis, Cynthia C. Hession, Ayan Ghoshal, Danielle Dionne, Sourav R. Choudhury, Volkan Yesilyurt, Neville E. Sanjana, Xi Shi, Congyi Lu, Matthias Heidenreich, Jen Q. Pan, Joshua Z. Levin & Feng Zhang. Nature Biomedical Engineering (Epub 09 April 2018) 10.1038/s41551-018-0219-9