Hy_pMT Flag-Hel25E MUT
(Plasmid
#110122)
-
PurposeExpresses Flag-tagged D. melanogaster Hel25E with 4 mutations that impact circRNA nuclear export activity
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneHy_pMT
- Total vector size (bp) 8496
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHel25E
-
SpeciesD. melanogaster (fly)
-
Mutation4 mutations (KKLN motif changed to RSFS)
-
Entrez GeneHel25E (a.k.a. Dmel_CG7269, CG7269, Dbp25F, DmRH4, Dmel\CG7269, HEL, HEL25E, Hel, UAP56, Uap56, WM6, Wm6, dHel25E, hel, jf26, l(2)25Eb, l(2)gdh-12, l(2)gdh12, l(2)jf26, l(2)k11511, sz, uap56)
- Promoter Metallothionein Promoter (pMT)
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACTCGAATTTGGAGCCGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pMT Flag-Hel25E MUT was a gift from Jeremy Wilusz (Addgene plasmid # 110122 ; http://n2t.net/addgene:110122 ; RRID:Addgene_110122) -
For your References section:
A length-dependent evolutionarily conserved pathway controls nuclear export of circular RNAs. Huang C, Liang D, Tatomer DC, Wilusz JE. Genes Dev. 2018 May 17. pii: gad.314856.118. doi: 10.1101/gad.314856.118. 10.1101/gad.314856.118 PubMed 29773557