pLXI_TRC401 SMARCB1 var 2
(Plasmid
#111182)
-
PurposeInducible vector (untagged) with SMARCB1 variant 2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLXI_TRC401
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 9354
- Total vector size (bp) 10484
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBAF47
-
Alt nameINI1
-
Alt nameBAF47
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1130
-
GenBank IDNM_001007468.2 NM_001007468.2
-
Entrez GeneSMARCB1 (a.k.a. BAF47, CSS3, INI-1, INI1, MRD15, PPP1R144, RDT, RTPS1, SNF5, SNF5L1, SWNTS1, Sfh1p, Snr1, hSNFS)
- Promoter TRE
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGAGGTAGGCGTGTACGGTG
- 3′ sequencing primer GACGTGAAGAATGTGCGAGAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLXI_TRC401 SMARCB1 var 2 was a gift from William Hahn (Addgene plasmid # 111182 ; http://n2t.net/addgene:111182 ; RRID:Addgene_111182) -
For your References section:
Renal medullary carcinomas depend upon SMARCB1 loss and are sensitive to proteasome inhibition. Hong AL, Tseng YY, Wala JA, Kim WJ, Kynnap BD, Doshi MB, Kugener G, Sandoval GJ, Howard TP, Li J, Yang X, Tillgren M, Ghandi M, Sayeed A, Deasy R, Ward A, McSteen B, Labella KM, Keskula P, Tracy A, Connor C, Clinton CM, Church AJ, Crompton BD, Janeway KA, Van Hare B, Sandak D, Gjoerup O, Bandopadhayay P, Clemons PA, Schreiber SL, Root DE, Gokhale PC, Chi SN, Mullen EA, Roberts CW, Kadoch C, Beroukhim R, Ligon KL, Boehm JS, Hahn WC. Elife. 2019 Mar 12;8. pii: 44161. doi: 10.7554/eLife.44161. 10.7554/eLife.44161 PubMed 30860482
