pUWL201PW-creDE
(Plasmid
#112241)
-
PurposeStreptomyces/E.coli shuttle expression vector encoding creD and creE
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUWL201PW
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsStreptomyces/E. coli shuttle vector. Ampicillin in E. coli. Thiostrepton in Streptomyces.
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namecreD
-
GenBank IDALA99201.1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GCACGCGGTCGATCTTGACGGCT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecreE
-
GenBank IDALA99202.1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GCACGCGGTCGATCTTGACGGCT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUWL201PW-creDE was a gift from Emily Balskus (Addgene plasmid # 112241 ; http://n2t.net/addgene:112241 ; RRID:Addgene_112241) -
For your References section:
Discovery of a Diazo-Forming Enzyme in Cremeomycin Biosynthesis. Waldman AJ, Balskus EP. J Org Chem. 2018 May 29. doi: 10.1021/acs.joc.8b00367. 10.1021/acs.joc.8b00367 PubMed 29771512