Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p426-SNR52p-gRNA.CAN1.Y-SUP4t
(Plasmid #43803)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 43803 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p426
  • Backbone size w/o insert (bp) 5886
  • Total vector size (bp) 6274
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAN1.y gRNA
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    488
  • Entrez Gene
    CAN1 (a.k.a. YEL063C)
  • Promoter SNR52

Cloning Information

Resource Information

Depositor Comments

For more information on Church Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/church/

gRNA target sequence GATACGTTCTCTATGGAGGA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p426-SNR52p-gRNA.CAN1.Y-SUP4t was a gift from George Church (Addgene plasmid # 43803)
  • For your References section:

    Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Dicarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM.. Nucleic Acids Res 10.1093/nar/gkt135 PubMed 23460208