pExp-mCherry
(Plasmid
#112569)
-
Purpose(Empty Backbone) Used for expression of protein in E. coli as TEV cleavable N-terminual 8His and mCherry (mCherry fluorescent protein,) fusions with optional C-terminal StrepII-tag
-
Depositing Lab
-
Depositing OrganizationUniversity of Cambridge
Located in United Kingdom of Great Britain and Northern Ireland -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepOP2S
-
Vector typeBacterial Expression
-
Tags
/ Fusion Proteins
- 8xHis (N terminal on backbone)
- mCherry (N terminal on backbone)
- Strep II (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pOP_up: TACGACTCACTATAGGGAATTGTGAGC
- 3′ sequencing primer pOP_dn: GCAGCCAACTCAGCTTCCTTTCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains N-terminal 8xHis, fusion partner: mCherry (mCherry fluorescent protein, UniProtKB: X5DSL3) followed by TEV protease cleavage site, optional C-terminal StrepII-tag. Cloning of GOI between BsaI and XhoI or HindIII
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pExp-mCherry was a gift from Marko Hyvönen (Addgene plasmid # 112569 ; http://n2t.net/addgene:112569 ; RRID:Addgene_112569)