Skip to main content

pExp-sfGFP
(Plasmid #112573)

  • Purpose
    (Empty Backbone) Used for expression of protein in E. coli as TEV cleavable N-terminual 8His and sfGFP (superfolder green fluorescent protein) fusions with optional C-terminal StrepII-tag
  • Depositing Lab
  • Depositing Organization
    University of Cambridge
    Located in United Kingdom of Great Britain and Northern Ireland
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112573 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pOP2S
  • Vector type
    Bacterial Expression
  • Tags / Fusion Proteins
    • 8xHis (N terminal on backbone)
    • sfGFP (N terminal on backbone)
    • Strep II (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pOP_up: TACGACTCACTATAGGGAATTGTGAGC
  • 3′ sequencing primer pOP_dn: GCAGCCAACTCAGCTTCCTTTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains N-terminal 8xHis, fusion partner: sfGFP (superfolder green fluorescent protein, PMID: 16369541) followed by TEV protease cleavage site, optional C-terminal StrepII-tag. Cloning of GOI between BsaI and XhoI or HindIII

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pExp-sfGFP was a gift from Marko Hyvönen (Addgene plasmid # 112573 ; http://n2t.net/addgene:112573 ; RRID:Addgene_112573)