Skip to main content

pCMV-SpdCas9-VP64
(Plasmid #115794)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115794 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV-Ef1a-FAS-EGFP-WPRE-pA
  • Backbone size w/o insert (bp) 3899
  • Total vector size (bp) 8855
  • Vector type
    Mammalian Expression, AAV
  • Selectable markers
    NONE

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VP64
  • Species
    S.pyogenes
  • Insert Size (bp)
    4452
  • Promoter CMV
  • Tags / Fusion Proteins
    • dCas9-VP64 (C terminal on insert)
    • 3XFLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATAACTTACGGTAAATGGCCCGC
  • 3′ sequencing primer GCCATAGAGCCCACCGCATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid: 47107

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-SpdCas9-VP64 was a gift from Nadav Ahituv (Addgene plasmid # 115794 ; http://n2t.net/addgene:115794 ; RRID:Addgene_115794)
  • For your References section:

    CRISPR-mediated activation of a promoter or enhancer rescues obesity caused by haploinsufficiency. Matharu N, Rattanasopha S, Tamura S, Maliskova L, Wang Y, Bernard A, Hardin A, Eckalbar WL, Vaisse C, Ahituv N. Science. 2018 Dec 13. pii: science.aau0629. doi: 10.1126/science.aau0629. 10.1126/science.aau0629 PubMed 30545847