pColE1_sgRNA_M7NS_AmpR
(Plasmid
#119157)
-
PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with seven mismatches in the non-seed region
-
Depositing Lab
-
Depositing OrganizationUniversity of Minnesota
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 119157-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 119157-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneYTK095
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with seven mismatches in the non-seed region
-
Alt namesgRNA-M7NS
-
gRNA/shRNA sequenceCCATTTTTTGTCAACACGCA
- Promoter J23119
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ttatagtcctgtcgggtttcg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Chase Beisel Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 119157-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 119157-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pColE1_sgRNA_M7NS_AmpR was a gift from Vincent Noireaux (Addgene plasmid # 119157 ; http://n2t.net/addgene:119157 ; RRID:Addgene_119157) -
For your References section:
An educational module to explore CRISPR technologies with a cell-free transcription-translation system. Collias D, Marshall R, Collins SP, Beisel CL, Noireaux V. Synth Biol (Oxf). 2019 Jan 21;4(1):ysz005. doi: 10.1093/synbio/ysz005. eCollection 2019. 10.1093/synbio/ysz005 PubMed 32995532