pAL942
(Plasmid #119721)

• Purpose: precursor slow-folding rbsB with the mutations Alanine 248 Threonine, Alanine 188 Cysteine and Glutamic acid 246 Cysteine
• Depositing Lab: Linda Randall
• Publication: Bariya et al J Bacteriol. 2018 Oct 1. pii: JB.00493-18. doi: 10.1128/JB.00493-18.

Backbone

• Vector backbone: pET11a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5677
• Total vector size (bp): 6535
• Modifications to backbone: Induce with IPTG
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): BL21.19
• Growth instructions: Change media and shift temperature to 39 degrees with IPTG added to produce the precursor proteins
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: precusor slow-folding ribose import binding protein, rbsB, mutations A248T, A118C and E246C
• Alt name: prlB, rbsP
• Species: Escherichia coli (strain K12)
• Insert Size (bp): 750
• Mutation: Alanine 248 to Threonine, Alanine 188 to Cysteine and Glutamate 246 to Cysteine
• GenBank ID: 948261
• Promoter: T7
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: 5' - CTTGACCGCCAGGCAACG - 3'
• 3′ sequencing primer: 5' - CCAGTTTCAGGATCAACCGG - 3'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Chankyu Park at Korea Advanced Institute of Science and Technology

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Vector contains T7 promoter, lacI coding sequence, pBR322 origin

Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at or contact our distributors if you have any questions.