Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGEX6P1-N-His
(Plasmid #119755)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119755 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-6-P1
  • Backbone manufacturer
    Amersham
  • Backbone size (bp) 5000
  • Modifications to backbone
    10xHis tag cloned into BamHI site of pGEX6P1, BamHI site only intact on 5' end
  • Vector type
    Bacterial Expression
  • Promoter tac promoter
  • Tags / Fusion Proteins
    • GST (N terminal on insert)
    • 10xHis (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer PGEX5' - GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer PGEX3' - CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1-N-His was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119755 ; http://n2t.net/addgene:119755 ; RRID:Addgene_119755)