Skip to main content

K9L mutant of H3K9me3 biosensor
(Plasmid #120807)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120807 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 120807-D50 50 μg of DNA in Tris buffer $495
DNA 120807-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAGGS vector
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 7021
  • Modifications to backbone
    one BsaI site was mutated for Golden Gate Assembly purpose
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Truncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
  • Species
    M. musculus (mouse), D. melanogaster (fly), Synthetic
  • Insert Size (bp)
    2304
  • Mutation
    lysine 9 is mutated to leucine 9 on histone H3
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCCTCTGCTAACCATGTTCATGCC
  • 3′ sequencing primer CAGATGCTCAAGGGGCTTCATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K9L mutant of H3K9me3 biosensor was a gift from Yingxiao Wang (Addgene plasmid # 120807 ; http://n2t.net/addgene:120807 ; RRID:Addgene_120807)
  • For your References section:

    Coordinated histone modifications and chromatin reorganization in a single cell revealed by FRET biosensors. Peng Q, Lu S, Shi Y, Pan Y, Limsakul P, Chernov AV, Qiu J, Chai X, Shi Y, Wang P, Ji Y, Li YJ, Strongin AY, Verkhusha VV, Izpisua Belmonte JC, Ren B, Wang Y, Chien S, Wang Y. Proc Natl Acad Sci U S A. 2018 Nov 26. pii: 1811818115. doi: 10.1073/pnas.1811818115. 10.1073/pnas.1811818115 PubMed 30478057