Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

C103m
(Plasmid #121007)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 121007 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mScarlet-I codon optimized with LAA tag
  • Species
    Synthetic
  • Insert Size (bp)
    746
  • Tag / Fusion Protein
    • LAA degradation tag for ssrA (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATAGGCGTATCACGAGGCA
  • 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Please see Supplemental Documents for annotated Genbank file.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    C103m was a gift from Richard Murray (Addgene plasmid # 121007 ; http://n2t.net/addgene:121007 ; RRID:Addgene_121007)